For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Supplemental Information A Combined Proteomics/Genomics Approach Links Hepatitis C Virus Infection with Nonsense-Mediated mRNA Decay

Molecular Cell. 2015; 
Holly R.RamageG. RenukaKumarErikVerschuerenJeffrey R.JohnsonJohnVon DollenTashaJohnsonBillyNewtonPriyaShahJulieHornerNevan J.KroganMelanieOtt
Products/Services Used Details Operation
Codon Optimization … pHR331 - HCV 2A NS3 C-terminal 3X flag pHR350 - HCV 2A NS5B (codon optimized by GenScript) N-terminal 3X flag … CTCCCTCGAGCGGCCGCACGGTCATGACC TCAAGGTCAG HCV 2A NS5B (codon optimized by GenScript) N- terminal 3X flag … Get A Quote

Abstract

Hepatitis C virus (HCV) is a leading cause of liver disease, but insight into virus-host interactions remains limited. We systematically used affinity purification/mass spectrometry to define the host interactions of all ten HCV proteins in hepatoma cells. We combined these studies with RNAi knockdown of corresponding genes using a two-step scoring approach to generate a map of 139 high-confidence HCV-host protein-protein interactions. We found mitochondrial proteins highly involved in HCV infection and characterized an interaction between the viral core protein and host protein within bgcn homolog (WIBG). Expression of core prevents WIBG from binding its regular interaction partners Y14 and Magoh, two kn... More

Keywords