Learn More
Learn More
Learn More
Learn More
Resources » Reference Databases » Citations Database
Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | ... The rigid alpha-helical linker was synthesized by Genscript (Piscataway, NJ, USA) including the restriction sites BamHI at the N-terminus and EcoRI at the C-terminus:GAGGCCGCCGCCCGGGAGGCCGCCGCCAGAGAGGC ... | Get A Quote |
The members of the nitric oxide synthase (NOS) family, eNOS, nNOS and iNOS, are well-characterized enzymes. However, due to the lack of suitable direct NO sensors, little is known about the kinetic properties of cellular NO generation by the different nitric oxide synthase isoenzymes. Very recently, we developed a novel class of fluorescent protein-based NO-probes, the geNOps, which allow real-time measurement of cellular NO generation and fluctuation. By applying these genetic NO biosensors to nNOS-, eNOS- and iNOS-expressing HEK293 cells we were able to characterize the respective NO dynamics in single cells that exhibited identical Ca2+ signaling as comparable activator of nNOS and eNOS. Our data demonstrate... More